Supramolecular insight into the substitution of sulfur by selenium, based on crystal structures

The complete sequence of a heterochromatic island from a higher eukaryote. The Cold Spring Harbor Laboratory, Washington University Genome Sequencing Center, and PE Biosystems Arabidopsis Sequencing Consortium.

Heterochromatin, constitutively condensed chromosomal material, is widespread among eukaryotes but incompletely characterized at the nucleotide level. We have sequenced and analyzed 2.1 megabases (Mb) of Arabidopsis thaliana chromosome 4 that includes 0.5-0.7 Mb of isolated heterochromatin that resembles the chromosomal knobs described by Barbara McClintock in maize.

This isolated region has a low density of expressed genes, low levels of recombination and a low incidence of genetrap insertion. Satellite repeats were absent, but tandem arrays of long repeats and many transposons were found. Methylation of these sequences was dependent on chromatin remodeling. Clustered repeats were associated with condensed chromosomal domains elsewhere. The complete sequence of a heterochromatic island provides an opportunity to study sequence determinants of chromosome condensation.

uwmembraneprotein
uwmembraneprotein
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Recombinant Human Galectin-1 Protein
PROTP09382-1 50ug
EUR 317
Description: Lectins, of either plant or animal origin, are carbohydrate binding proteins that interact with glycoprotein and glycolipids on the surface of animal cells. The Galectins are lectins that recognize and interact with β-galactoside moieties. Galectin-1 is an animal lectin that has been shown to interact with CD3, CD4, and CD45. It induces apoptosis of activated T-cells and T-leukemia cell lines and inhibits the protein phosphatase activity of CD45. Recombinant human Galectin-1 is a 14.5 kDa protein containing 134 amino acid residues.
Anti-Galectin-3 Monoclonal Antibody
M00621-1 100ul
EUR 397
Description: Mouse Monoclonal Galectin-3 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
anti-Galectin 1
YF-PA12945 100 ug
EUR 403
Description: Rabbit polyclonal to Galectin 1
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
anti- Galectin-1 antibody
FNab03314 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: lectin, galactoside-binding, soluble, 1
  • Uniprot ID: P09382
  • Gene ID: 3956
  • Research Area: Cell Division and Proliferation, Cardiovascular, Signal Transduction
Description: Antibody raised against Galectin-1
anti- Galectin-1 antibody
FNab03315 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: lectin, galactoside-binding, soluble, 1
  • Uniprot ID: P09382
  • Gene ID: 3956
  • Research Area: Cell Division and Proliferation, Cardiovascular, Signal Transduction
Description: Antibody raised against Galectin-1
Anti-Galectin 1 Antibody
A00470-2 100ug/vial
EUR 294
Anti-Galectin-1 antibody
PAab03314 100 ug
EUR 355
Anti-Galectin-1 antibody
STJ93201 200 µl
EUR 197
Description: Rabbit polyclonal to Galectin-1.
Anti-Galectin-1 antibody
STJ98716 200 µl
EUR 197
Description: Rabbit polyclonal to Galectin-1.
Anti-Galectin 1 (1A8)
YF-MA13984 100 ug
EUR 363
Description: Mouse monoclonal to Galectin 1
Anti-Galectin 1/Lgals1 Antibody
A00470 100ug/vial
EUR 334
Anti-Galectin 1 Biotinylated Antibody
A00470-Biotin 50ug/vial
EUR 294
Anti-Galectin 1/LGALS1 Antibody
PB9240 100ug/vial
EUR 334
anti-Galectin 1 (1E8-1B2)
LF-MA10174 100 ug
EUR 363
Description: Mouse monoclonal to Galectin 1
Anti-Galectin 1/LGALS1 Antibody
PA1422 100ug/vial
EUR 334
Anti-galectin-1 (mouse) antibody
STJ72519 100 µg
EUR 359
Anti-Galectin-13 (GAL13) / Placental Protein 13 (PP13) Monoclonal Antibody
M08143-1 100ug/vial
EUR 397
Description: Mouse Monoclonal Galectin-13 (GAL13) / Placental Protein 13 (PP13) Antibody. Validated in IHC and tested in Human.
anti-Galectin 3
YF-PA12946 50 ug
EUR 363
Description: Mouse polyclonal to Galectin 3
anti-Galectin 3
YF-PA12947 100 ul
EUR 403
Description: Rabbit polyclonal to Galectin 3
anti-Galectin 3
YF-PA12948 100 ug
EUR 403
Description: Rabbit polyclonal to Galectin 3
anti-Galectin 8
YF-PA12951 50 ul
EUR 363
Description: Mouse polyclonal to Galectin 8
anti-Galectin 3
YF-PA24079 50 ul
EUR 334
Description: Mouse polyclonal to Galectin 3
anti-galectin 9
YF-PA24081 50 ul
EUR 334
Description: Mouse polyclonal to galectin 9
anti-Galectin 13
YF-PA18585 50 ug
EUR 363
Description: Mouse polyclonal to Galectin 13
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
LGALS8 Human, Galectin-8 Human Recombinant Protein, His Tag
PROTO00214-1 Regular: 10ug
EUR 317
Description: LGALS8 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 337 amino acids (1-317 a.a.) and having a molecular mass of 37.9 kDa. The LGALS8 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.
LGALS3 Human, Galectin-3 Human Recombinant Protein, His Tag
PROTP17931-1 Regular: 25ug
EUR 317
Description: LGALS3 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 270 amino acids (1-250 a.a.) and having a molecular mass of 28.3 kDa._x000D_ The LGALS3 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques. _x000D_
LGALS7 Human, Galectin-7 Human Recombinant Protein, His Tag
PROTP47929-1 Regular: 20ug
EUR 317
Description: Galectin-7 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 156 amino acids (1-136 a.a.) and having a molecular mass of 17.2kDa. ;The Galectin-7 is purified by proprietary chromatographic techniques.
Anti-human Galectin-3 antibody
STJ15100163 250 µg
EUR 336
Description: This monoclonal antibody is for studies of antigen expression in cells and tissue sections using immunocytochemistry and immunoprecipitation
Human Galectin-3 (Gal-3) AssayMax ELISA Kit
EG3311-1 96 Well Plate
EUR 477
Human Galectin-4 (Gal-4) AssayMax ELISA Kit
EG3312-1 96 Well Plate
EUR 477
Human Galectin 1 Protein
20-abx066725
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Galectin-1, human recombinant
4648-10
EUR 142
Galectin-1, human recombinant
4648-1000
EUR 1648
Galectin-1, human recombinant
4648-50
EUR 262
Recombinant Human Galectin-1
7-00427 10µg Ask for price
Recombinant Human Galectin-1
7-00428 50µg Ask for price
Recombinant Human Galectin-1
7-00429 1mg Ask for price
Human Galectin-1 (LGALS1)
1-CSB-EP012882HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Galectin-1(LGALS1) expressed in E.coli
Human Galectin-1 (LGALS1)
1-CSB-EP012882HUb1
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Galectin-1(LGALS1) expressed in E.coli
anti- Galectin 2 antibody
FNab03310 100µg
EUR 585
  • Immunogen: lectin, galactoside-binding, soluble, 2
  • Uniprot ID: P05162
  • Research Area: Immunology, Signal Transduction, Cell Division and Proliferation
Description: Antibody raised against Galectin 2
anti- Galectin 4 antibody
FNab03311 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: lectin, galactoside-binding, soluble, 4
  • Uniprot ID: P56470
  • Research Area: Immunology, Signal Transduction, Cell Division and Proliferation
Description: Antibody raised against Galectin 4
anti- Galectin 8 antibody
FNab03312 100µg
EUR 505.25
  • Immunogen: lectin, galactoside-binding, soluble, 8
  • Uniprot ID: O00214
  • Research Area: Immunology, Signal Transduction, Cell Division and Proliferation
Description: Antibody raised against Galectin 8
anti- Galectin 9 antibody
FNab03313 100µg
EUR 505.25
  • Immunogen: lectin, galactoside-binding, soluble, 9
  • Uniprot ID: O00182
  • Research Area: Immunology, Signal Transduction, Cell Division and Proliferation
Description: Antibody raised against Galectin 9
anti- Galectin-3 antibody
FNab03316 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: lectin, galactoside-binding, soluble, 3
  • Uniprot ID: P17931
  • Research Area: Cardiovascular, Cancer, Immunology, Neuroscience, Cell Division and Prolife
  • Show more
Description: Antibody raised against Galectin-3
anti- Galectin-3 antibody
FNab03317 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:5000
  • IHC: 1:50-1:200
  • IF: 1:20-1:200
  • Immunogen: lectin, galactoside-binding, soluble, 3
  • Uniprot ID: P17931
  • Research Area: Cardiovascular, Cancer, Immunology, Neuroscience, Cell Division and Proliferation
Description: Antibody raised against Galectin-3
anti- Galectin-7 antibody
FNab03318 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:20-1:200
  • Immunogen: lectin, galactoside-binding, soluble, 7B
  • Uniprot ID: P47929
  • Gene ID: 653499
  • Research Area: Immunology, Cancer, Immunology, Neuroscience, Cell Division and Proliferation
Description: Antibody raised against Galectin-7
Anti-Galectin-9 Antibody
A03415 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Galectin-9 Antibody (LGALS9) detection.tested for WB in Human, Mouse, Rat.
Anti-Galectin 2 antibody
PAab03310 100 ug
EUR 412
Anti-Galectin 4 antibody
PAab03311 100 ug
EUR 355
Anti-Galectin 8 antibody
PAab03312 100 ug
EUR 355
Anti-Galectin 9 antibody
PAab03313 100 ug
EUR 355
Anti-Galectin-3 antibody
PAab03316 100 ug
EUR 355
Anti-Galectin-7 antibody
PAab03318 100 ug
EUR 355
anti-Galectin-3 (6G2)
LF-MA20336 100 ug
EUR 354
Description: Mouse monoclonal to Galectin-3
Anti-Galectin 3 antibody
STJ73098 100 µg
EUR 359
Anti-Galectin-2 antibody
STJ93202 200 µl
EUR 197
Description: Rabbit polyclonal to Galectin-2.
Anti-Galectin-4 antibody
STJ93203 200 µl
EUR 197
Description: Rabbit polyclonal to Galectin-4.
Anti-Galectin-7 antibody
STJ93204 200 µl
EUR 197
Description: Rabbit polyclonal to Galectin-7.
Anti-Galectin-8 antibody
STJ93205 200 µl
EUR 197
Description: Rabbit polyclonal to Galectin-8.
Anti-Galectin-9 antibody
STJ93206 200 µl
EUR 197
Description: Rabbit polyclonal to Galectin-9.
Anti-Galectin-3 antibody
STJ96945 200 µl
EUR 197
Description: Galectin-3 is a protein encoded by the LGALS3 gene which is approximately 26,1 kDa. Galectin-3 is localised to the cytoplasm and nucleus. It is involved in NF-kappaB signalling, advanced glycosylation end product receptor signalling and cell adhesion. It is a galactose-specific lectin which binds IgE and may mediate the stimulation by CSPG4 of endothelial cells migration along with the alpha-3, beta-1 integrin. It is characterized by an N-terminal proline-rich tandem repeat domain and a single C-terminal carbohydrate recognition domain. Galectin-3 is expressed mainly in the colonic epithelium and is also abundantly expressed in activated macrophages. Mutations in the LGALS3 gene may result in follicular adenoma and thyroid cancer. STJ96945 was developed from clone 6G2 and was affinity-purified from mouse ascites by affinity-chromatography using specific immunogen. This antibody detects endogenous galectin-3 proteins.
Anti-Galectin-3 antibody
STJ97549 200 µl
EUR 197
Description: Mouse monoclonal to Galectin-3 (6B8).
Anti-Galectin-3 antibody
STJ97550 200 µl
EUR 197
Description: Mouse monoclonal to Galectin-3 (8D7).
Anti-Galectin-3 antibody
STJ97551 200 µl
EUR 197
Description: Mouse monoclonal to Galectin-3 (5D9).
Anti-Galectin-3 antibody
STJ97601 200 µl
EUR 197
Description: Mouse monoclonal to Galectin-3 (2F9).
Anti-Galectin-3 antibody
STJ97604 200 µl
EUR 197
Description: Mouse monoclonal to Galectin-3 (16E6).
Anti-Galectin-3 antibody
STJ97605 200 µl
EUR 197
Description: Mouse monoclonal to Galectin-3 (1H4).
Anti-Galectin-3 antibody
STJ97715 200 µl
EUR 197
Description: Mouse monoclonal to Galectin-3.
Anti-Galectin-3 antibody
STJ16100369 1 mL
EUR 1047
Anti-Galectin-3 antibody
STJ16100782 100 µg
EUR 720
Anti-Galectin-3 antibody
STJ180106 0.1 ml
EUR 212
Anti-Galectin 3 antibody
STJ190057 200 µl
EUR 197
Description: Unconjugated Mouse monoclonal to Galectin 3 (AS1A24)
Anti-Galectin 8 (3E5)
YF-MA13986 100 ug
EUR 363
Description: Mouse monoclonal to Galectin 8
Anti-galectin-1 (mouse) (aa100-112) antibody
STJ72520 100 µg
EUR 359
Anti Human Galectin-3 Polyclonal Antibody
KH040
EUR 649
Description: The Anti Human Galectin-3 Polyclonal Antibody is available in Europe and for worldwide shipping via Gentaur.
Anti-Galectin-1 / Human Placental Lactogen (hPL) Monoclonal Antibody
M00470 100ug/vial
EUR 397
Description: Mouse Monoclonal Galectin-1 / Human Placental Lactogen (hPL) Antibody. Validated in IHC and tested in Human.
rHu Galectin-1
AK8281-0010 10µg Ask for price
rHu Galectin-1
AK8281-0050 50µg Ask for price
rHu Galectin-1
AK8281-0100 100µg Ask for price
rHu Galectin-1
AK8281-1000 1mg Ask for price
Galectin-1 Protein
20-abx261634
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Galectin-1 Protein
20-abx263505
  • EUR 230.00
  • EUR 1790.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.
Galectin 1 antibody
70R-49997 100 ul
EUR 244
Description: Purified Polyclonal Galectin 1 antibody
Galectin 1 antibody
70R-GR002 100 ug
EUR 476
Description: Affinity purified Rabbit polyclonal Galectin 1 antibody
Galectin-1 Antibody
3596-100
EUR 316
Galectin-1 Antibody
3596-30T
EUR 146
Galectin 1 Antibody
49673-100ul 100ul
EUR 333
Galectin 1 Antibody
49673-50ul 50ul
EUR 239
Galectin 1 protein
30R-1385 100 ug
EUR 224
Description: Purified recombinant Human Galectin 1 protein
Galectin 1 protein
30R-2371 50 ug
EUR 353
Description: Purified recombinant Human Galectin 1 protein
Galectin 1 protein
30R-AG003 10 ug
EUR 133
Description: Purified recombinant Human Galectin 1 protein
Galectin 1 antibody
70R-11939 100 ug
EUR 403
Description: Rabbit polyclonal Galectin 1 antibody
Galectin 1 antibody
70R-13963 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal Galectin 1 antibody
Galectin-1 (LGAS1)
PR27143 50 ug
EUR 318
Human Galectin-1 (Gal-1) Antibody
30005-05111 150 ug
EUR 261
Human Galectin-1 (LGALS1) Protein
abx670211-50ug 50 ug
EUR 551
  • Shipped within 1 week.
Human Galectin 1 ELISA kit
E01G0038-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Galectin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Galectin 1 ELISA kit
E01G0038-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Galectin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Galectin 1 ELISA kit
E01G0038-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Galectin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Recombinant Human Galectin-1 Protein
RP00007 20 μg
EUR 174
Anti-Apaf-1 (human) Monoclonal Antibody (2E12)
M00889-1 100ug
EUR 432
Description: Rat Monoclonal Apaf-1 (human) Antibody (2E12). Validated in ELISA, IP, IF, WB and tested in Human.
Anti-Galectin 10/CLC Antibody
A01350 100ug/vial
EUR 294
Anti-Galectin 3/LGALS3 Antibody
PB9279 100ug/vial
EUR 334
Anti-Galectin 8/LGALS8 Antibody
PB9659 100ug/vial
EUR 294
Anti-galectin 9/LGALS9 Antibody
PB9660 100ug/vial
EUR 294
Anti-Galectin 3/LGALS3 Antibody
PB9081 100ug/vial
EUR 334
Anti-galectin-3 (mouse) antibody
STJ72518 100 µg
EUR 359
Anti-Galectin-3 10301 antibody
STJ400238 1 mg
EUR 446
Anti-Galectin-3 10302 antibody
STJ400239 1 mg
EUR 446
Anti-Galectin-3 10303 antibody
STJ400240 1 mg
EUR 446
Anti-Galectin-3 10304 antibody
STJ400241 1 mg
EUR 446
Anti-Galectin-3 10305 antibody
STJ400242 1 mg
EUR 446
Anti-PARP-1 Antibody
A00122-1 100ul
EUR 397
Description: Rabbit Polyclonal PARP-1 Antibody. Validated in ELISA, IP, IF, WB and tested in Human, Mouse.
Anti-Presenilin 1 Antibody
A00138-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Presenilin 1 Antibody (PSEN1) detection. Tested with WB, IHC in Human, Mouse, Rat.
Anti-PAI-1 Antibody
A00637-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for PAI-1 Antibody (SERPINE1) detection.tested for WB in Human, Mouse, Rat.
Anti-Flk-1 Antibody
A00901-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Flk-1 Antibody (KDR) detection.tested for WB in Human, Mouse.
Anti-EDG-1 Antibody
A01502-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for EDG-1 Antibody (S1PR1) detection.tested for WB in Human, Mouse, Rat.
Anti-ROBO-1 Antibody
A01530-1 100ug
EUR 455
Description: Rabbit Polyclonal ROBO-1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-Bag-1 Antibody
A02423-1 50 ul
EUR 397
Description: Rabbit Polyclonal Bag-1 Antibody. Validated in IP, IHC and tested in Bovine, Canine, Human, Mouse, Rat.
Anti-TUB 1 Antibody
A02917-1 100ug/vial
EUR 294
Anti-Dok-1 Antibody
A03039-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Dok-1 Antibody (DOK1) detection.tested for WB in Human, Mouse, Rat.
Anti-TFIIIB90-1 Antibody
A03761-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TFIIIB90-1 Antibody (BRF1) detection.tested for WB in Human, Mouse.
Anti-Atrophin-1 Antibody
A03828-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Atrophin-1 Antibody (ATN1) detection. Tested with WB in Human, Mouse, Rat.
Anti-CNG-1 Antibody
A05494-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CNG-1 Antibody (CNGA1) detection. Tested with WB in Human, Mouse, Rat.
Anti-Periphilin 1 Antibody
A06996-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Periphilin 1 Antibody (PPHLN1) detection.tested for WB in Human, Mouse.
Anti-Lyl-1 Antibody
A07491-1 100ul
EUR 397
Description: Rabbit Polyclonal Lyl-1 Antibody. Validated in IHC and tested in Human, Mouse, Rat.
Anti-GLI-1 Antibody
A07972-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GLI-1 Antibody (ACSS1) detection. Tested with WB in Human, Mouse, Rat.
Anti-Cerebellin 1 Antibody
A09176-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Cerebellin 1 Antibody (CBLN1) detection. Tested with WB in Human, Mouse, Rat.
Anti-DOC-1 Antibody
A09467-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for DOC-1 Antibody (CDK2AP1) detection. Tested with WB in Human, Mouse.
Anti-NPDC-1 Antibody
A12846-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NPDC-1 Antibody (NPDC1) detection. Tested with WB in Human, Mouse, Rat.
Anti-P-glycoprotein (human) Monoclonal Antibody (JSB-1)
M00049-1 125ug
EUR 586
Description: Mouse Monoclonal P-glycoprotein (human) Antibody (JSB-1). Validated in IF and tested in Human.
Polyclonal Galectin-1 Antibody
APR00144G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Galectin-1 . This antibody is tested and proven to work in the following applications:
Galectin 1 Conjugated Antibody
C49673 100ul
EUR 397
Polyclonal Galectin-1 Antibody
APR03538G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Galectin-1 . This antibody is tested and proven to work in the following applications:
Polyclonal Galectin 1 Antibody
APR05577G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Galectin 1 . This antibody is tested and proven to work in the following applications:
Galectin-1 Polyclonal Antibody
ES6104-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Galectin-1 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Galectin-1 Polyclonal Antibody
ES6104-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Galectin-1 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Galectin-1 Polyclonal Antibody
ES8653-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Galectin-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
Galectin-1 Polyclonal Antibody
ES8653-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Galectin-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
Galectin 1 (LGALS1) Antibody
20-abx126090
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Galectin 1 (GAL1) Antibody
20-abx129970
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Galectin 1 (GAL1) Antibody
20-abx130429
  • EUR 467.00
  • EUR 133.00
  • EUR 1372.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Galectin 1 (GAL1) Antibody
20-abx131977
  • EUR 356.00
  • EUR 913.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Galectin-1 Polyclonal Antibody
ABP58605-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human Galectin-1 protein at amino acid sequence of 30-80
  • Applications tips:
Description: A polyclonal antibody for detection of Galectin-1 from Human, Mouse, Rat. This Galectin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Galectin-1 protein at amino acid sequence of 30-80
Galectin-1 Polyclonal Antibody
ABP58605-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human Galectin-1 protein at amino acid sequence of 30-80
  • Applications tips:
Description: A polyclonal antibody for detection of Galectin-1 from Human, Mouse, Rat. This Galectin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Galectin-1 protein at amino acid sequence of 30-80
Galectin-1 Polyclonal Antibody
ABP58605-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human Galectin-1 protein at amino acid sequence of 30-80
  • Applications tips:
Description: A polyclonal antibody for detection of Galectin-1 from Human, Mouse, Rat. This Galectin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Galectin-1 protein at amino acid sequence of 30-80
Galectin 1 Blocking Peptide
20-abx062872
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Galectin 1 (GAL1) Antibody
20-abx100527
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 425.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Galectin 1 (LGALS1) Antibody
20-abx100528
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Galectin 1 (LGALS1) Antibody
20-abx100529
  • EUR 1163.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.
Galectin 1 (GAL1) Antibody
20-abx100530
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Galectin 1 (LGALS1) Antibody
20-abx009043
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Galectin 1 (LGALS1) Antibody
20-abx006748
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Galectin-1 (LEG1) Antibody
20-abx014039
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Supramolecular insight into the substitution of sulfur by selenium, based on crystal structures, quantum-chemical calculations and biosystem recognition

Statistical analysis of data from crystal structures extracted from the Cambridge Structural Database (CSD) has shown that S and Se atoms display a similar tendency towards specific types of interaction if they are part of a fragment that corresponds to the side chains of cysteine (Cys), methionine (Met) selenocysteine (Sec) and selenomethionine (Mse).

  • The most numerous are structures with C-H…Se and C-H…S interactions (∼80%), notably less numerous are structures with Se…Se and S…S interactions (∼5%), and Se…π and S…π interactions are the least numerous.

  • The results of quantum-chemical calculations have indicated that C-H…Se (∼-0.8 kcal mol-1) and C-H...S interactions are weaker than the most stable parallel interaction (∼-3.3 kcal mol-1) and electrostatic interactions of σ/π type (∼-2.6 kcal mol-1).
  • Their significant presence can be explained by the abundance of CH groups compared with the numbers of Se and S atoms in the crystal structures, and also by the influence of substituents bonded to the Se or S atom that further reduce their possibilities for interacting with species from the environment.
  • This can also offer an explanation as to why O-H…Se (∼-4.4 kcal mol-1) and N-H…Se interactions (∼-2.2 kcal mol-1) are less numerous. Docking studies revealed that S and Se rarely participate in interactions with the amino acid residues of target enzymes, mostly because those residues preferentially interact with the substituents bonded to Se and S.
  • The differences between Se and S ligands in the number and positions of their binding sites are more pronounced if the substituents are polar and if there are more Se/S atoms in the ligand.

A simple biosystem for the high-yielding cascade conversion of racemic alcohols to enantiopure amines

The amination of racemic alcohols to produce enantiopure amines is an important green chemistry reaction for pharmaceutical manufacturing, requiring simple and efficient solutions. Here we developed a novel concept and the simplest system for ADH-TA-catalyzed cascade reaction to aminate racemic alcohols, which utilizes an ambidextrous ADH to oxidize a racemic alcohol, an enantioselective transaminase to convert the ketone intermediate to chiral amine, and isopropylamine to recycle PMP and NAD + cofactors via the reversed cascade reactions.

The concept was proven by using an ambidextrous CpSADH-W286A engineered from ( S )-enantioselective CpSADH as the first example of evolving ambidextrous ADHs, an enantioselective BmTA, and isopropylamine. A biosystem containing isopropylamine and the cells of E. coli (CpSADH-W286A/BmTA) expressing the two enzymes was developed for the amination of racemic alcohols to produce eight useful and high-value ( S )-amines in 72-99% yield and 98-99% ee , providing with a simple and practical solution to this type of reaction.

Evaluation of chromosomal insertion loci in the Pseudomonas putida KT2440 genome for predictable biosystems design

The development of Pseudomonas strains for industrial production of fuels and chemicals will require the integration of heterologous genes and pathways into the chromosome.

Finding the most appropriate integration site to maximize strain performance is an essential part of the strain design process. We characterized seven chromosomal loci in Pseudomonas putida KT2440 for integration of a fluorescent protein expression construct. Insertion in five of the loci did not affect growth rate, but fluorescence varied by up to 27-fold.

Three sites displaying a diversity of phenotypes with the fluorescent reporter were also chosen for the integration of a gene encoding a muconate importer. Depending on the integration locus, expression of the importer varied by approximately 3-fold and produced significant phenotypic differences. This work demonstrates the impact of the integration location on host viability, gene expression, and overall strain performance.

GRO / KC (CXCL1) Protein

20-abx260684
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

GRO / KC (CXCL1) Protein

20-abx261870
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

GRO1/KC Mouse Recombinant Protein (CXCL1)

PROTP12850-1 Regular: 20ug
EUR 317
Description: KC Mouse Recombinant also known as N51 and GRO1 produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 77 amino acids and having a molecular mass of approximately 8 kDa.;The GRO-1 is purified by proprietary chromatographic techniques.

Recombinant Mouse (E.Coli) GRO/KC (CXCL1)

RP-1037 5 ug
EUR 164

GRO/KC (CXCL1), Rat Recombinant

P1288-25
EUR 370

GRO/KC (CXCL1), Rat Recombinant

P1288-5
EUR 175

Recombinant Murine KC (CXCL1) Protein

PROTP12850-2 20ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant murine KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

GRO, KC, CXCL1, rRtGRO, rat

RC352-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

GRO1/KC Mouse, GRO/KC (CXCL1) Mouse Recombinant Protein, His Tag

PROTP12850 Regular: 20ug
EUR 317
Description: GRO1/KC Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 97 amino acids (25-96 a.a.) and having a molecular mass of 10.5kDa.;GRO1 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GRO-alpha, KC, CXCL1 (rMuKC), murine (mouse)

RC332-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Recombinant Rat GRO/KC (CXCL1) Protein

PROTP14095-1 25ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant rat GRO/KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

Rat CXCL1/CINC-1/KC ELISA Kit

RK00196 96 Tests
EUR 521

KC protein (Mouse)

30R-AK001 20 ug
EUR 273
Description: Purified recombinant Mouse KC protein

Anti-CXCL1 antibody

STJ72026 100 µg
EUR 260

Anti-CXCL1 antibody

STJ28366 100 µl
EUR 277
Description: This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4.

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Rabbit Anti Mouse Cxcl1 Polyclonal Antibody

CPBT-65100RM 0.1 mg
EUR 881

KC antibody

70R-KR006 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal KC antibody

KC Antibody

5211-100
EUR 376

KC Antibody

5212-100
EUR 392

KC Antibody

5212-30T
EUR 146

KC antibody

20R-1786 100 ug
EUR 651
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12297 100 ug
EUR 527
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12298 100 ug
EUR 492
Description: Rabbit polyclonal KC antibody

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90006 20 ug
EUR 1025
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90007 100 ug
EUR 2725
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

Anti-GRO alpha/Cxcl1 Antibody

A00533 100ug/vial
EUR 294

Anti-GRO alpha/CXCL1 Antibody

PA1760 100ug/vial
EUR 294

Polyclonal KC Antibody

APR16969G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KC . This antibody is tested and proven to work in the following applications:

KC 12291 hydrochloride

B7332-10 10 mg
EUR 373

KC 12291 hydrochloride

B7332-50 50 mg
EUR 1363

KC Blocking Peptide

33R-11041 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KC antibody, catalog no. 70R-12298

KC Blocking Peptide

5212BP-50
EUR 153

GRO-alpha/CXCL1, Mouse

HY-P7188 50ug
EUR 533

Mouse CXCL1 ELISA Kit

55R-1741 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory

Mouse CXCL1 shRNA Plasmid

20-abx970673
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CXCL1 siRNA

20-abx901350
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CXCL1/GRO

E21-597 10ug
EUR 343

CXCL1/GRO

EF012822 96 Tests
EUR 689

CXCL1 siRNA

20-abx913248
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CXCL1 siRNA

20-abx913249
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CXCL1 Antibody

43679-100ul 100ul
EUR 252

CXCL1 protein

30R-3156 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein

CXCL1 Antibody

33054-100ul 100ul
EUR 252

CXCL1 antibody

70R-14297 100 ug
EUR 327
Description: Affinity purified Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-10502 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-15473 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-16681 50 ul
EUR 435
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 Antibody

1-CSB-PA006239GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CXCL1 Antibody

1-CSB-PA009036
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

Cxcl1 Antibody

1-CSB-PA09217A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

CXCL1 Antibody

1-CSB-PA06097A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

pEGFP- CXCL1

PVT10178 2 ug
EUR 301

Rabbit Anti Rat Cxcl1 Polyclonal Antibody

CPBT-65101RR 0.1 mg
EUR 881

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

KiloGreen 2X qPCR MasterMix-iCycler

MasterMix-KC 4 x 1.25 ml - 500 reactions (20 ul)
EUR 140

GRO/KC, murine recombinant

4210-100
EUR 773

GRO/KC, murine recombinant

4210-1000
EUR 3856

GRO/KC, murine recombinant

4210-20
EUR 256

ELISA kit for Mouse CXCL1

EK5299 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CXCL1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse CXCL1 PicoKine ELISA Kit

EK0723 96 wells
EUR 456
Description: For quantitative detection of mouse CXCL1 in cell culture supernates and serum.

CXCL1 protein (Mouse) (His tag)

80R-3368 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

CXCL1 protein (Mouse) (His tag)

80R-3439 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

Mouse CXCL1 Detection Assay Kit

6725 1 kit
EUR 483.55
Description: Mouse CXCL1 Detection Assay Kit

Mouse CXCL1/GROα ELISA kit

LF-EK50473 1×96T
EUR 648

Cxcl1 ORF Vector (Mouse) (pORF)

ORF042286 1.0 ug DNA
EUR 95

CXCL1 ELISA Kit (Mouse) (OKAN04583)

OKAN04583 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.0 pg/mL

CXCL1 ELISA Kit (Mouse) (OKBB00312)

OKBB00312 96 Tests
EUR 544
Description: Description of target: Chemokine (C-X-C motif) ligand 1 (CXCL1) is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GROα, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-α). In humans, this protein is encoded by the CXCL1 gene. The gene for CXCL1 is located on human chromosome 4 amongst genes for other CXC chemokines. The mature form of CXCL1 is maximally 73 amino acids long. CXCL1 is secreted by human melanoma cells, has mitogenic properties and is implicated in melanoma pathogenesis. CXCL1 is expressed by macrophages, neutrophils and epithelial cells, and has neutrophil chemoattractant activity. This chemokine elicits its effects by signaling through the chemokine receptor CXCR2.CXCL1 decreased the severity of multiple sclerosis and may offer a neuro-protective function. The standard product used in this kit is recombinant mouse CXCL1, consisting of 77 amino acids with the molecular mass of 8KDa.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 1 pg/ml

CXCL1 ELISA Kit (Mouse) (OKCD05712)

OKCD05712 96 Wells
EUR 609
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.0pg/mL

KC ELISA Kit (Mouse) : 96 Wells (OKAG00090)

OKAG00090 96 Wells
EUR 596
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 8 pg/mL

CXCL1 Conjugated Antibody

C33054 100ul
EUR 397

CXCL1 cloning plasmid

CSB-CL006239HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 324
  • Sequence: atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaag
  • Show more
Description: A cloning plasmid for the CXCL1 gene.

CXCL1 Blocking Peptide

20-abx061039
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Cxcl1 Polyclonal Antibody

A51950 100 µg
EUR 570.55
Description: fast delivery possible

CXCL1 Polyclonal Antibody

A51978 100 µg
EUR 570.55
Description: kits suitable for this type of research

CXCL1 Blocking Peptide

33R-7741 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL1 antibody, catalog no. 70R-10502

CXCL1 antibody (HRP)

60R-2236 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (HRP)

CXCL1 antibody (FITC)

60R-2237 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (FITC)

CXCL1 antibody (biotin)

60R-2238 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (biotin)

Recombinant Human CXCL1

P0109 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1

pCMV-SPORT6-CXCL1

PVT13291 2 ug
EUR 391

GRO-alpha/CXCL1 (CHO-expressed), Mouse

HY-P7186 50ug
EUR 337

Mouse CXCL1 AssayLite Antibody (FITC Conjugate)

70027-05141 150 ug
EUR 428

Cxcl1 sgRNA CRISPR Lentivector set (Mouse)

K4368201 3 x 1.0 ug
EUR 339

Mouse Growth-regulated alpha protein (Cxcl1)

1-CSB-RP092174m
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Growth-regulated alpha protein(Cxcl1),partial expressed in E.coli

Mouse CXCL1/GROα ELISA kit (4X96T)

LF-EK50474 4×96T
EUR 2201

Rat CXCL1 shRNA Plasmid

20-abx986581
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CXCL1 ELISA Kit

ELA-E1210h 96 Tests
EUR 824

CXCL1 ELISA KIT|Human

EF003720 96 Tests
EUR 689

GRO-alpha/CXCL1, Human

HY-P7187 10ug
EUR 268

GRO-alpha/CXCL1, Rat

HY-P7189 50ug
EUR 533

GRO alpha (CXCL1) Antibody

abx018005-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

GRO alpha (CXCL1) Protein

20-abx260406
  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

GRO alpha (CXCL1) Protein

20-abx261582
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

GRO alpha (CXCL1) Protein

20-abx261606
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

CXCL1 protein (His tag)

80R-2265 100 ug
EUR 424
Description: Purified recombinant Mouse CXCL1 Protein (His tag)

Human CXCL1 ELISA Kit

55R-1740 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory

Rat CXCL1 ELISA Kit

55R-1742 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory

Human CXCL1 shRNA Plasmid

20-abx951972
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Cxcl1 Antibody, HRP conjugated

1-CSB-PA09217B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Cxcl1 Antibody, FITC conjugated

1-CSB-PA09217C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Cxcl1 Antibody, Biotin conjugated

1-CSB-PA09217D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

CXCL1 Antibody, HRP conjugated

1-CSB-PA06097B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CXCL1 Antibody, FITC conjugated

1-CSB-PA06097C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CXCL1 Antibody, Biotin conjugated

1-CSB-PA06097D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human CXCL1 ELISA Kit

LF-EK50891 1×96T
EUR 648

pEGFP- N1- CXCL1 Plasmid

PVT7155 2 ug
EUR 266

Leave a Reply

Your email address will not be published. Required fields are marked *