Supramolecular insight into the substitution of sulfur by selenium, based on crystal structures

The complete sequence of a heterochromatic island from a higher eukaryote. The Cold Spring Harbor Laboratory, Washington University Genome Sequencing Center, and PE Biosystems Arabidopsis Sequencing Consortium.

Heterochromatin, constitutively condensed chromosomal material, is widespread among eukaryotes but incompletely characterized at the nucleotide level. We have sequenced and analyzed 2.1 megabases (Mb) of Arabidopsis thaliana chromosome 4 that includes 0.5-0.7 Mb of isolated heterochromatin that resembles the chromosomal knobs described by Barbara McClintock in maize.

This isolated region has a low density of expressed genes, low levels of recombination and a low incidence of genetrap insertion. Satellite repeats were absent, but tandem arrays of long repeats and many transposons were found. Methylation of these sequences was dependent on chromatin remodeling. Clustered repeats were associated with condensed chromosomal domains elsewhere. The complete sequence of a heterochromatic island provides an opportunity to study sequence determinants of chromosome condensation.

uwmembraneprotein
uwmembraneprotein
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280.00
Recombinant Human Galectin-1 Protein
PROTP09382-1 50ug
EUR 317.00
Description: Lectins, of either plant or animal origin, are carbohydrate binding proteins that interact with glycoprotein and glycolipids on the surface of animal cells. The Galectins are lectins that recognize and interact with β-galactoside moieties. Galectin-1 is an animal lectin that has been shown to interact with CD3, CD4, and CD45. It induces apoptosis of activated T-cells and T-leukemia cell lines and inhibits the protein phosphatase activity of CD45. Recombinant human Galectin-1 is a 14.5 kDa protein containing 134 amino acid residues.
Anti-Galectin-3 Monoclonal Antibody
M00621-1 100ul
EUR 397.00
Description: Mouse Monoclonal Galectin-3 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
anti-Galectin 1
YF-PA12945 100 ug
EUR 403.00
Description: Rabbit polyclonal to Galectin 1
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349.00
anti- Galectin-1 antibody
FNab03314 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: lectin, galactoside-binding, soluble, 1
  • Uniprot ID: P09382
  • Gene ID: 3956
  • Research Area: Cell Division and Proliferation, Cardiovascular, Signal Transduction
Description: Antibody raised against Galectin-1
anti- Galectin-1 antibody
FNab03315 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: lectin, galactoside-binding, soluble, 1
  • Uniprot ID: P09382
  • Gene ID: 3956
  • Research Area: Cell Division and Proliferation, Cardiovascular, Signal Transduction
Description: Antibody raised against Galectin-1
Anti-Galectin 1 Antibody
A00470-2 100ug/vial
EUR 294.00
Anti-Galectin-1 antibody
PAab03314 100 ug
EUR 355.00
Anti-Galectin-1 antibody
STJ93201 200 µl
EUR 197.00
Description: Rabbit polyclonal to Galectin-1.
Anti-Galectin-1 antibody
STJ98716 200 µl
EUR 197.00
Description: Rabbit polyclonal to Galectin-1.
Anti-Galectin 1 (1A8)
YF-MA13984 100 ug
EUR 363.00
Description: Mouse monoclonal to Galectin 1
Anti-Galectin 1/Lgals1 Antibody
A00470 100ug/vial
EUR 334.00
Anti-Galectin 1 Biotinylated Antibody
A00470-Biotin 50ug/vial
EUR 294.00
Anti-Galectin 1/LGALS1 Antibody
PB9240 100ug/vial
EUR 334.00
anti-Galectin 1 (1E8-1B2)
LF-MA10174 100 ug
EUR 363.00
Description: Mouse monoclonal to Galectin 1
Anti-Galectin 1/LGALS1 Antibody
PA1422 100ug/vial
EUR 334.00
Anti-galectin-1 (mouse) antibody
STJ72519 100 µg
EUR 359.00
Anti-Galectin-13 (GAL13) / Placental Protein 13 (PP13) Monoclonal Antibody
M08143-1 100ug/vial
EUR 397.00
Description: Mouse Monoclonal Galectin-13 (GAL13) / Placental Protein 13 (PP13) Antibody. Validated in IHC and tested in Human.
anti-Galectin 3
YF-PA12946 50 ug
EUR 363.00
Description: Mouse polyclonal to Galectin 3
anti-Galectin 3
YF-PA12947 100 ul
EUR 403.00
Description: Rabbit polyclonal to Galectin 3
anti-Galectin 3
YF-PA12948 100 ug
EUR 403.00
Description: Rabbit polyclonal to Galectin 3
anti-Galectin 8
YF-PA12951 50 ul
EUR 363.00
Description: Mouse polyclonal to Galectin 8
anti-Galectin 13
YF-PA18585 50 ug
EUR 363.00
Description: Mouse polyclonal to Galectin 13
anti-Galectin 3
YF-PA24079 50 ul
EUR 334.00
Description: Mouse polyclonal to Galectin 3
anti-galectin 9
YF-PA24081 50 ul
EUR 334.00
Description: Mouse polyclonal to galectin 9
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280.00
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280.00
LGALS8 Human, Galectin-8 Human Recombinant Protein, His Tag
PROTO00214-1 Regular: 10ug
EUR 317.00
Description: LGALS8 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 337 amino acids (1-317 a.a.) and having a molecular mass of 37.9 kDa. The LGALS8 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.
LGALS3 Human, Galectin-3 Human Recombinant Protein, His Tag
PROTP17931-1 Regular: 25ug
EUR 317.00
Description: LGALS3 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 270 amino acids (1-250 a.a.) and having a molecular mass of 28.3 kDa._x000D_ The LGALS3 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques. _x000D_
LGALS7 Human, Galectin-7 Human Recombinant Protein, His Tag
PROTP47929-1 Regular: 20ug
EUR 317.00
Description: Galectin-7 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 156 amino acids (1-136 a.a.) and having a molecular mass of 17.2kDa. ;The Galectin-7 is purified by proprietary chromatographic techniques.
Anti-human Galectin-3 antibody
STJ15100163 250 µg
EUR 336.00
Description: This monoclonal antibody is for studies of antigen expression in cells and tissue sections using immunocytochemistry and immunoprecipitation
Human Galectin-3 (Gal-3) AssayMax ELISA Kit
EG3311-1 96 Well Plate
EUR 477.00
Human Galectin-4 (Gal-4) AssayMax ELISA Kit
EG3312-1 96 Well Plate
EUR 477.00
Human Galectin 1 Protein
20-abx066725
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Galectin-1, human recombinant
4648-10
EUR 142.00
Galectin-1, human recombinant
4648-1000
EUR 1648.00
Galectin-1, human recombinant
4648-50
EUR 262.00
Recombinant Human Galectin-1
7-00427 10µg Ask for price
Recombinant Human Galectin-1
7-00428 50µg Ask for price
Recombinant Human Galectin-1
7-00429 1mg Ask for price
Human Galectin-1 (LGALS1)
1-CSB-EP012882HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 30.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Galectin-1(LGALS1) expressed in E.coli
Human Galectin-1 (LGALS1)
1-CSB-EP012882HUb1
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 19.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Galectin-1(LGALS1) expressed in E.coli
anti- Galectin 2 antibody
FNab03310 100µg
EUR 585.00
  • Immunogen: lectin, galactoside-binding, soluble, 2
  • Uniprot ID: P05162
  • Research Area: Immunology, Signal Transduction, Cell Division and Proliferation
Description: Antibody raised against Galectin 2
anti- Galectin 4 antibody
FNab03311 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: lectin, galactoside-binding, soluble, 4
  • Uniprot ID: P56470
  • Research Area: Immunology, Signal Transduction, Cell Division and Proliferation
Description: Antibody raised against Galectin 4
anti- Galectin 8 antibody
FNab03312 100µg
EUR 505.25
  • Immunogen: lectin, galactoside-binding, soluble, 8
  • Uniprot ID: O00214
  • Research Area: Immunology, Signal Transduction, Cell Division and Proliferation
Description: Antibody raised against Galectin 8
anti- Galectin 9 antibody
FNab03313 100µg
EUR 505.25
  • Immunogen: lectin, galactoside-binding, soluble, 9
  • Uniprot ID: O00182
  • Research Area: Immunology, Signal Transduction, Cell Division and Proliferation
Description: Antibody raised against Galectin 9
anti- Galectin-3 antibody
FNab03316 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: lectin, galactoside-binding, soluble, 3
  • Uniprot ID: P17931
  • Research Area: Cardiovascular, Cancer, Immunology, Neuroscience, Cell Division and Prolife
  • Show more
Description: Antibody raised against Galectin-3
anti- Galectin-3 antibody
FNab03317 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:5000
  • IHC: 1:50-1:200
  • IF: 1:20-1:200
  • Immunogen: lectin, galactoside-binding, soluble, 3
  • Uniprot ID: P17931
  • Research Area: Cardiovascular, Cancer, Immunology, Neuroscience, Cell Division and Proliferation
Description: Antibody raised against Galectin-3
anti- Galectin-7 antibody
FNab03318 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:20-1:200
  • Immunogen: lectin, galactoside-binding, soluble, 7B
  • Uniprot ID: P47929
  • Gene ID: 653499
  • Research Area: Immunology, Cancer, Immunology, Neuroscience, Cell Division and Proliferation
Description: Antibody raised against Galectin-7
Anti-Galectin-9 Antibody
A03415 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for Galectin-9 Antibody (LGALS9) detection.tested for WB in Human, Mouse, Rat.
Anti-Galectin 2 antibody
PAab03310 100 ug
EUR 412.00
Anti-Galectin 4 antibody
PAab03311 100 ug
EUR 355.00
Anti-Galectin 8 antibody
PAab03312 100 ug
EUR 355.00
Anti-Galectin 9 antibody
PAab03313 100 ug
EUR 355.00
Anti-Galectin-3 antibody
PAab03316 100 ug
EUR 355.00
Anti-Galectin-7 antibody
PAab03318 100 ug
EUR 355.00
anti-Galectin-3 (6G2)
LF-MA20336 100 ug
EUR 354.00
Description: Mouse monoclonal to Galectin-3
Anti-Galectin 3 antibody
STJ73098 100 µg
EUR 359.00
Anti-Galectin-2 antibody
STJ93202 200 µl
EUR 197.00
Description: Rabbit polyclonal to Galectin-2.
Anti-Galectin-4 antibody
STJ93203 200 µl
EUR 197.00
Description: Rabbit polyclonal to Galectin-4.
Anti-Galectin-7 antibody
STJ93204 200 µl
EUR 197.00
Description: Rabbit polyclonal to Galectin-7.
Anti-Galectin-8 antibody
STJ93205 200 µl
EUR 197.00
Description: Rabbit polyclonal to Galectin-8.
Anti-Galectin-9 antibody
STJ93206 200 µl
EUR 197.00
Description: Rabbit polyclonal to Galectin-9.
Anti-Galectin-3 antibody
STJ96945 200 µl
EUR 197.00
Description: Galectin-3 is a protein encoded by the LGALS3 gene which is approximately 26,1 kDa. Galectin-3 is localised to the cytoplasm and nucleus. It is involved in NF-kappaB signalling, advanced glycosylation end product receptor signalling and cell adhesion. It is a galactose-specific lectin which binds IgE and may mediate the stimulation by CSPG4 of endothelial cells migration along with the alpha-3, beta-1 integrin. It is characterized by an N-terminal proline-rich tandem repeat domain and a single C-terminal carbohydrate recognition domain. Galectin-3 is expressed mainly in the colonic epithelium and is also abundantly expressed in activated macrophages. Mutations in the LGALS3 gene may result in follicular adenoma and thyroid cancer. STJ96945 was developed from clone 6G2 and was affinity-purified from mouse ascites by affinity-chromatography using specific immunogen. This antibody detects endogenous galectin-3 proteins.
Anti-Galectin-3 antibody
STJ97549 200 µl
EUR 197.00
Description: Mouse monoclonal to Galectin-3 (6B8).
Anti-Galectin-3 antibody
STJ97550 200 µl
EUR 197.00
Description: Mouse monoclonal to Galectin-3 (8D7).
Anti-Galectin-3 antibody
STJ97551 200 µl
EUR 197.00
Description: Mouse monoclonal to Galectin-3 (5D9).
Anti-Galectin-3 antibody
STJ97601 200 µl
EUR 197.00
Description: Mouse monoclonal to Galectin-3 (2F9).
Anti-Galectin-3 antibody
STJ97604 200 µl
EUR 197.00
Description: Mouse monoclonal to Galectin-3 (16E6).
Anti-Galectin-3 antibody
STJ97605 200 µl
EUR 197.00
Description: Mouse monoclonal to Galectin-3 (1H4).
Anti-Galectin-3 antibody
STJ97715 200 µl
EUR 197.00
Description: Mouse monoclonal to Galectin-3.
Anti-Galectin-3 antibody
STJ16100369 1 mL
EUR 1047.00
Anti-Galectin-3 antibody
STJ16100782 100 µg
EUR 720.00
Anti-Galectin-3 antibody
STJ180106 0.1 ml
EUR 212.00
Anti-Galectin 3 antibody
STJ190057 200 µl
EUR 197.00
Description: Unconjugated Mouse monoclonal to Galectin 3 (AS1A24)
Anti-Galectin 8 (3E5)
YF-MA13986 100 ug
EUR 363.00
Description: Mouse monoclonal to Galectin 8
Anti-galectin-1 (mouse) (aa100-112) antibody
STJ72520 100 µg
EUR 359.00
Anti Human Galectin-3 Polyclonal Antibody
KH040
EUR 649.00
Description: The Anti Human Galectin-3 Polyclonal Antibody is available in Europe and for worldwide shipping via Gentaur.
Anti-Galectin-1 / Human Placental Lactogen (hPL) Monoclonal Antibody
M00470 100ug/vial
EUR 397.00
Description: Mouse Monoclonal Galectin-1 / Human Placental Lactogen (hPL) Antibody. Validated in IHC and tested in Human.
rHu Galectin-1
AK8281-0010 10µg Ask for price
rHu Galectin-1
AK8281-0050 50µg Ask for price
rHu Galectin-1
AK8281-0100 100µg Ask for price
rHu Galectin-1
AK8281-1000 1mg Ask for price
Galectin-1 Protein
20-abx261634
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
Galectin-1 Protein
20-abx263505
  • EUR 230.00
  • EUR 1790.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
Galectin 1 antibody
70R-49997 100 ul
EUR 244.00
Description: Purified Polyclonal Galectin 1 antibody
Galectin 1 antibody
70R-GR002 100 ug
EUR 476.00
Description: Affinity purified Rabbit polyclonal Galectin 1 antibody
Galectin-1 Antibody
3596-100
EUR 316.00
Galectin-1 Antibody
3596-30T
EUR 146.00
Galectin 1 Antibody
49673-100ul 100ul
EUR 333.00
Galectin 1 Antibody
49673-50ul 50ul
EUR 239.00
Galectin 1 protein
30R-1385 100 ug
EUR 224.00
Description: Purified recombinant Human Galectin 1 protein
Galectin 1 protein
30R-2371 50 ug
EUR 353.00
Description: Purified recombinant Human Galectin 1 protein
Galectin 1 protein
30R-AG003 10 ug
EUR 133.00
Description: Purified recombinant Human Galectin 1 protein
Galectin 1 antibody
70R-11939 100 ug
EUR 403.00
Description: Rabbit polyclonal Galectin 1 antibody
Galectin 1 antibody
70R-13963 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal Galectin 1 antibody
Galectin-1 (LGAS1)
PR27143 50 ug
EUR 318.00
Human Galectin-1 (Gal-1) Antibody
30005-05111 150 ug
EUR 261.00
Human Galectin-1 (LGALS1) Protein
abx670211-50ug 50 ug
EUR 551.00
  • Shipped within 1 week.
Human Galectin 1 ELISA kit
E01G0038-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Galectin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Galectin 1 ELISA kit
E01G0038-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Galectin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Galectin 1 ELISA kit
E01G0038-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Galectin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Recombinant Human Galectin-1 Protein
RP00007 20 μg
EUR 174.00
Anti-Apaf-1 (human) Monoclonal Antibody (2E12)
M00889-1 100ug
EUR 432.00
Description: Rat Monoclonal Apaf-1 (human) Antibody (2E12). Validated in ELISA, IP, IF, WB and tested in Human.
Anti-Galectin 10/CLC Antibody
A01350 100ug/vial
EUR 294.00
Anti-Galectin 3/LGALS3 Antibody
PB9279 100ug/vial
EUR 334.00
Anti-Galectin 8/LGALS8 Antibody
PB9659 100ug/vial
EUR 294.00
Anti-galectin 9/LGALS9 Antibody
PB9660 100ug/vial
EUR 294.00
Anti-Galectin 3/LGALS3 Antibody
PB9081 100ug/vial
EUR 334.00
Anti-galectin-3 (mouse) antibody
STJ72518 100 µg
EUR 359.00
Anti-Galectin-3 10301 antibody
STJ400238 1 mg
EUR 446.00
Anti-Galectin-3 10302 antibody
STJ400239 1 mg
EUR 446.00
Anti-Galectin-3 10303 antibody
STJ400240 1 mg
EUR 446.00
Anti-Galectin-3 10304 antibody
STJ400241 1 mg
EUR 446.00
Anti-Galectin-3 10305 antibody
STJ400242 1 mg
EUR 446.00
Anti-PARP-1 Antibody
A00122-1 100ul
EUR 397.00
Description: Rabbit Polyclonal PARP-1 Antibody. Validated in ELISA, IP, IF, WB and tested in Human, Mouse.
Anti-Presenilin 1 Antibody
A00138-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for Presenilin 1 Antibody (PSEN1) detection. Tested with WB, IHC in Human, Mouse, Rat.
Anti-PAI-1 Antibody
A00637-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for PAI-1 Antibody (SERPINE1) detection.tested for WB in Human, Mouse, Rat.
Anti-Flk-1 Antibody
A00901-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for Flk-1 Antibody (KDR) detection.tested for WB in Human, Mouse.
Anti-EDG-1 Antibody
A01502-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for EDG-1 Antibody (S1PR1) detection.tested for WB in Human, Mouse, Rat.
Anti-ROBO-1 Antibody
A01530-1 100ug
EUR 455.00
Description: Rabbit Polyclonal ROBO-1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-Bag-1 Antibody
A02423-1 50 ul
EUR 397.00
Description: Rabbit Polyclonal Bag-1 Antibody. Validated in IP, IHC and tested in Bovine, Canine, Human, Mouse, Rat.
Anti-TUB 1 Antibody
A02917-1 100ug/vial
EUR 294.00
Anti-Dok-1 Antibody
A03039-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for Dok-1 Antibody (DOK1) detection.tested for WB in Human, Mouse, Rat.
Anti-TFIIIB90-1 Antibody
A03761-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for TFIIIB90-1 Antibody (BRF1) detection.tested for WB in Human, Mouse.
Anti-Atrophin-1 Antibody
A03828-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for Atrophin-1 Antibody (ATN1) detection. Tested with WB in Human, Mouse, Rat.
Anti-CNG-1 Antibody
A05494-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for CNG-1 Antibody (CNGA1) detection. Tested with WB in Human, Mouse, Rat.
Anti-Periphilin 1 Antibody
A06996-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for Periphilin 1 Antibody (PPHLN1) detection.tested for WB in Human, Mouse.
Anti-Lyl-1 Antibody
A07491-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Lyl-1 Antibody. Validated in IHC and tested in Human, Mouse, Rat.
Anti-GLI-1 Antibody
A07972-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for GLI-1 Antibody (ACSS1) detection. Tested with WB in Human, Mouse, Rat.
Anti-Cerebellin 1 Antibody
A09176-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for Cerebellin 1 Antibody (CBLN1) detection. Tested with WB in Human, Mouse, Rat.
Anti-DOC-1 Antibody
A09467-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for DOC-1 Antibody (CDK2AP1) detection. Tested with WB in Human, Mouse.
Anti-NPDC-1 Antibody
A12846-1 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for NPDC-1 Antibody (NPDC1) detection. Tested with WB in Human, Mouse, Rat.
Anti-P-glycoprotein (human) Monoclonal Antibody (JSB-1)
M00049-1 125ug
EUR 586.00
Description: Mouse Monoclonal P-glycoprotein (human) Antibody (JSB-1). Validated in IF and tested in Human.
Human Galectin-1(LGALS1) ELISA kit
E01G0448-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Galectin-1(LGALS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Galectin-1(LGALS1) ELISA kit
E01G0448-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Galectin-1(LGALS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Galectin-1(LGALS1) ELISA kit
E01G0448-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Galectin-1(LGALS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Human Galectin-1
EK5323 96 tests
EUR 553.00
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Galectin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human Galectin-1 PicoKine ELISA Kit
EK0762 96 wells
EUR 425.00
Description: For quantitative detection of human Galectin-1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Human LGALS1/ Galectin-1 ELISA Kit
E1450Hu 1 Kit
EUR 537.00
Human LGALS1(Galectin-1) ELISA Kit
EH0626 96T
EUR 524.10
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: P09382
  • Alias: GAL1(Galectin 1 )/LGALS1/BHL/Galaptin/GBP/L-14/14 kDa laminin-binding protein/Gal-1/galectin 1/galectin-1/GBP/HBL/HLBP14/HPL/Lactose-binding lectin 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml
Human Galectin- 1, LGALS1 ELISA KIT
ELI-06950h 96 Tests
EUR 824.00
Human Galectin 1 (LGALS1) ELISA Kit
20-abx151618
  • EUR 5640.00
  • EUR 3009.00
  • EUR 707.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.
Human Galectin 1 (GAL1) CLIA Kit
20-abx190336
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.
Human Galectin 1 (LGALS1) ELISA Kit
abx351576-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.
Human Galectin 1 (LGALS1) ELISA Kit
abx253591-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.
Human Galectin 1 (GAL1) CLIA Kit
abx196676-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.
Human Galectin 1 (GAL1) ELISA kit
201-12-3227 96 tests
EUR 440.00
  • This Galectin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Galectin 1 (GAL1) ELISA Kit
DLR-GAL1-Hu-48T 48T
EUR 479.00
  • Should the Human Galectin 1 (GAL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Galectin 1 (GAL1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Galectin 1 (GAL1) ELISA Kit
DLR-GAL1-Hu-96T 96T
EUR 621.00
  • Should the Human Galectin 1 (GAL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Galectin 1 (GAL1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Galectin-1(LGALS1) ELISA kit
CSB-EL012882HU-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Galectin-1 (LGALS1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Galectin-1(LGALS1) ELISA kit
1-CSB-EL012882HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 0
  • 1
  • 2
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Galectin-1(LGALS1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
LGALS1 Galectin-1 Human Recombinant Protein
PROTP09382 Regular: 50ug
EUR 317.00
Description: LGALS1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 135 amino acids and having a molecular mass of 14.7kDa.;The LGALS1 is purified by proprietary chromatographic techniques.
Galectin 1 (GAL1) Polyclonal Antibody (Human)
4-PAA321Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: Met1~Asp135
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Galectin 1 (GAL1)
Human Galectin 1 (GAL1) ELISA Kit
SEA321Hu-10x96wellstestplate 10x96-wells test plate
EUR 3409.41
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Galectin 1 (GAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Galectin 1 (GAL1) in serum, plasma, tissue homogenates and other biological fluids.
Human Galectin 1 (GAL1) ELISA Kit
SEA321Hu-1x48wellstestplate 1x48-wells test plate
EUR 368.42
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Galectin 1 (GAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Galectin 1 (GAL1) in serum, plasma, tissue homogenates and other biological fluids.
Human Galectin 1 (GAL1) ELISA Kit
SEA321Hu-1x96wellstestplate 1x96-wells test plate
EUR 483.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Galectin 1 (GAL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Galectin 1 (GAL1) in serum, plasma, tissue homogenates and other biological fluids.

Supramolecular insight into the substitution of sulfur by selenium, based on crystal structures, quantum-chemical calculations and biosystem recognition

Statistical analysis of data from crystal structures extracted from the Cambridge Structural Database (CSD) has shown that S and Se atoms display a similar tendency towards specific types of interaction if they are part of a fragment that corresponds to the side chains of cysteine (Cys), methionine (Met) selenocysteine (Sec) and selenomethionine (Mse).

  • The most numerous are structures with C-H…Se and C-H…S interactions (∼80%), notably less numerous are structures with Se…Se and S…S interactions (∼5%), and Se…π and S…π interactions are the least numerous.

  • The results of quantum-chemical calculations have indicated that C-H…Se (∼-0.8 kcal mol-1) and C-H...S interactions are weaker than the most stable parallel interaction (∼-3.3 kcal mol-1) and electrostatic interactions of σ/π type (∼-2.6 kcal mol-1).
  • Their significant presence can be explained by the abundance of CH groups compared with the numbers of Se and S atoms in the crystal structures, and also by the influence of substituents bonded to the Se or S atom that further reduce their possibilities for interacting with species from the environment.
  • This can also offer an explanation as to why O-H…Se (∼-4.4 kcal mol-1) and N-H…Se interactions (∼-2.2 kcal mol-1) are less numerous. Docking studies revealed that S and Se rarely participate in interactions with the amino acid residues of target enzymes, mostly because those residues preferentially interact with the substituents bonded to Se and S.
  • The differences between Se and S ligands in the number and positions of their binding sites are more pronounced if the substituents are polar and if there are more Se/S atoms in the ligand.

A simple biosystem for the high-yielding cascade conversion of racemic alcohols to enantiopure amines

The amination of racemic alcohols to produce enantiopure amines is an important green chemistry reaction for pharmaceutical manufacturing, requiring simple and efficient solutions. Here we developed a novel concept and the simplest system for ADH-TA-catalyzed cascade reaction to aminate racemic alcohols, which utilizes an ambidextrous ADH to oxidize a racemic alcohol, an enantioselective transaminase to convert the ketone intermediate to chiral amine, and isopropylamine to recycle PMP and NAD + cofactors via the reversed cascade reactions.

The concept was proven by using an ambidextrous CpSADH-W286A engineered from ( S )-enantioselective CpSADH as the first example of evolving ambidextrous ADHs, an enantioselective BmTA, and isopropylamine. A biosystem containing isopropylamine and the cells of E. coli (CpSADH-W286A/BmTA) expressing the two enzymes was developed for the amination of racemic alcohols to produce eight useful and high-value ( S )-amines in 72-99% yield and 98-99% ee , providing with a simple and practical solution to this type of reaction.

Evaluation of chromosomal insertion loci in the Pseudomonas putida KT2440 genome for predictable biosystems design

The development of Pseudomonas strains for industrial production of fuels and chemicals will require the integration of heterologous genes and pathways into the chromosome.

Finding the most appropriate integration site to maximize strain performance is an essential part of the strain design process. We characterized seven chromosomal loci in Pseudomonas putida KT2440 for integration of a fluorescent protein expression construct. Insertion in five of the loci did not affect growth rate, but fluorescence varied by up to 27-fold.

Three sites displaying a diversity of phenotypes with the fluorescent reporter were also chosen for the integration of a gene encoding a muconate importer. Depending on the integration locus, expression of the importer varied by approximately 3-fold and produced significant phenotypic differences. This work demonstrates the impact of the integration location on host viability, gene expression, and overall strain performance.

GRO / KC (CXCL1) Protein

20-abx260684
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

GRO / KC (CXCL1) Protein

20-abx261870
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

GRO1/KC Mouse Recombinant Protein (CXCL1)

PROTP12850-1 Regular: 20ug
EUR 317.00
Description: KC Mouse Recombinant also known as N51 and GRO1 produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 77 amino acids and having a molecular mass of approximately 8 kDa.;The GRO-1 is purified by proprietary chromatographic techniques.

Recombinant Mouse (E.Coli) GRO/KC (CXCL1)

RP-1037 5 ug
EUR 164.00

GRO/KC (CXCL1), Rat Recombinant

P1288-25
EUR 370.00

GRO/KC (CXCL1), Rat Recombinant

P1288-5
EUR 175.00

Recombinant Murine KC (CXCL1) Protein

PROTP12850-2 20ug
EUR 317.00
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant murine KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

GRO, KC, CXCL1, rRtGRO, rat

RC352-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

GRO1/KC Mouse, GRO/KC (CXCL1) Mouse Recombinant Protein, His Tag

PROTP12850 Regular: 20ug
EUR 317.00
Description: GRO1/KC Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 97 amino acids (25-96 a.a.) and having a molecular mass of 10.5kDa.;GRO1 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GRO-alpha, KC, CXCL1 (rMuKC), murine (mouse)

RC332-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Recombinant Rat GRO/KC (CXCL1) Protein

PROTP14095-1 25ug
EUR 317.00
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant rat GRO/KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

Rat CXCL1/CINC-1/KC ELISA Kit

RK00196 96 Tests
EUR 521.00

KC protein (Mouse)

30R-AK001 20 ug
EUR 273.00
Description: Purified recombinant Mouse KC protein

Anti-CXCL1 antibody

STJ28366 100 µl
EUR 277.00
Description: This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4.

Anti-CXCL1 antibody

STJ72026 100 µg
EUR 260.00

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349.00

Rabbit Anti Mouse Cxcl1 Polyclonal Antibody

CPBT-65100RM 0.1 mg
EUR 881.00

KC antibody

20R-1786 100 ug
EUR 651.00
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12297 100 ug
EUR 527.00
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12298 100 ug
EUR 492.00
Description: Rabbit polyclonal KC antibody

KC Antibody

5211-100
EUR 376.00

KC Antibody

5212-100
EUR 392.00

KC Antibody

5212-30T
EUR 146.00

KC antibody

70R-KR006 50 ug
EUR 273.00
Description: Affinity purified Rabbit polyclonal KC antibody

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90006 20 ug
EUR 1025.00
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90007 100 ug
EUR 2725.00
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

Anti-GRO alpha/Cxcl1 Antibody

A00533 100ug/vial
EUR 294.00

Anti-GRO alpha/CXCL1 Antibody

PA1760 100ug/vial
EUR 294.00

KC Blocking Peptide

33R-11041 50 ug
EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KC antibody, catalog no. 70R-12298

KC Blocking Peptide

5212BP-50
EUR 153.00

Polyclonal KC Antibody

APR16969G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KC . This antibody is tested and proven to work in the following applications:

KC 12291 hydrochloride

B7332-10 10 mg
EUR 373.00

KC 12291 hydrochloride

B7332-50 50 mg
EUR 1363.00

Mouse CXCL1 ELISA Kit

55R-1741 1 kit
EUR 624.00
Description: ELISA kit for detection of CXCL1 in the research laboratory

Mouse CXCL1 shRNA Plasmid

20-abx970673
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GRO-alpha/CXCL1, Mouse

HY-P7188 50ug
EUR 533.00

CXCL1 protein

30R-3156 50 ug
EUR 257.00
Description: Purified recombinant CXCL1 protein

CXCL1 antibody

70R-16681 50 ul
EUR 435.00
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-10502 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-14297 100 ug
EUR 327.00
Description: Affinity purified Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-15473 100 ug
EUR 327.00
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 Antibody

33054-100ul 100ul
EUR 252.00

CXCL1 Antibody

43679-100ul 100ul
EUR 252.00

CXCL1 Antibody

1-CSB-PA006239GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CXCL1 Antibody

1-CSB-PA06097A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Cxcl1 Antibody

1-CSB-PA09217A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

CXCL1/GRO

E21-597 10ug
EUR 343.00

CXCL1/GRO

EF012822 96 Tests
EUR 689.00

CXCL1 Antibody

1-CSB-PA009036
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

CXCL1 siRNA

20-abx901350
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CXCL1 siRNA

20-abx913248
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CXCL1 siRNA

20-abx913249
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

pEGFP- CXCL1

PVT10178 2 ug
EUR 301.00

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anti Rat Cxcl1 Polyclonal Antibody

CPBT-65101RR 0.1 mg
EUR 881.00

KiloGreen 2X qPCR MasterMix-iCycler

MasterMix-KC 4 x 1.25 ml - 500 reactions (20 ul)
EUR 140.00

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280.00

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280.00

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280.00

GRO/KC, murine recombinant

4210-100
EUR 773.00

GRO/KC, murine recombinant

4210-1000
EUR 3856.00

GRO/KC, murine recombinant

4210-20
EUR 256.00

Mouse CXCL1 Detection Assay Kit

6725 1 kit
EUR 483.55
Description: Mouse CXCL1 Detection Assay Kit

CXCL1 protein (Mouse) (His tag)

80R-3368 50 ug
EUR 257.00
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

CXCL1 protein (Mouse) (His tag)

80R-3439 50 ug
EUR 257.00
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

ELISA kit for Mouse CXCL1

EK5299 96 tests
EUR 553.00
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CXCL1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse CXCL1 PicoKine ELISA Kit

EK0723 96 wells
EUR 456.00
Description: For quantitative detection of mouse CXCL1 in cell culture supernates and serum.

Mouse CXCL1/GROα ELISA kit

LF-EK50473 1×96T
EUR 648.00

Cxcl1 ORF Vector (Mouse) (pORF)

ORF042286 1.0 ug DNA
EUR 95.00

CXCL1 Blocking Peptide

33R-7741 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL1 antibody, catalog no. 70R-10502

CXCL1 antibody (HRP)

60R-2236 100 ug
EUR 327.00
Description: Rabbit polyclonal CXCL1 antibody (HRP)

CXCL1 antibody (FITC)

60R-2237 100 ug
EUR 327.00
Description: Rabbit polyclonal CXCL1 antibody (FITC)

CXCL1 antibody (biotin)

60R-2238 100 ug
EUR 327.00
Description: Rabbit polyclonal CXCL1 antibody (biotin)

CXCL1 Blocking Peptide

20-abx061039
  • EUR 286.00
  • EUR 425.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CXCL1 Conjugated Antibody

C33054 100ul
EUR 397.00

CXCL1 cloning plasmid

CSB-CL006239HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 324
  • Sequence: atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaag
  • Show more
Description: A cloning plasmid for the CXCL1 gene.

Cxcl1 Polyclonal Antibody

A51950 100 µg
EUR 570.55
Description: fast delivery possible

CXCL1 Polyclonal Antibody

A51978 100 µg
EUR 570.55
Description: kits suitable for this type of research

Recombinant Human CXCL1

P0109 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1

Recombinant Human CXCL1

P0207 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1

pCMV-SPORT6-CXCL1

PVT13291 2 ug
EUR 391.00

Mouse CXCL1 AssayLite Antibody (FITC Conjugate)

70027-05141 150 ug
EUR 428.00

Mouse Growth-regulated alpha protein (Cxcl1)

1-CSB-RP092174m
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 11.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Growth-regulated alpha protein(Cxcl1),partial expressed in E.coli

GRO-alpha/CXCL1 (CHO-expressed), Mouse

HY-P7186 50ug
EUR 337.00

Cxcl1 sgRNA CRISPR Lentivector set (Mouse)

K4368201 3 x 1.0 ug
EUR 339.00

Mouse CXCL1/GROα ELISA kit (4X96T)

LF-EK50474 4×96T
EUR 2201.00

Human CXCL1 ELISA Kit

55R-1740 1 kit
EUR 624.00
Description: ELISA kit for detection of CXCL1 in the research laboratory

Rat CXCL1 ELISA Kit

55R-1742 1 kit
EUR 624.00
Description: ELISA kit for detection of CXCL1 in the research laboratory

CXCL1 Antibody, HRP conjugated

1-CSB-PA06097B0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CXCL1 Antibody, FITC conjugated

1-CSB-PA06097C0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CXCL1 Antibody, Biotin conjugated

1-CSB-PA06097D0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Cxcl1 Antibody, HRP conjugated

1-CSB-PA09217B0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Cxcl1 Antibody, FITC conjugated

1-CSB-PA09217C0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Cxcl1 Antibody, Biotin conjugated

1-CSB-PA09217D0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

CXCL1 protein (His tag)

80R-2265 100 ug
EUR 424.00
Description: Purified recombinant Mouse CXCL1 Protein (His tag)

GRO alpha (CXCL1) Antibody

abx018005-100ug 100 ug
EUR 342.00
  • Shipped within 5-10 working days.

GRO alpha (CXCL1) Protein

20-abx260406
  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

GRO alpha (CXCL1) Protein

20-abx261582
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

GRO alpha (CXCL1) Protein

20-abx261606
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Human CXCL1 ELISA Kit

ELA-E1210h 96 Tests
EUR 824.00

CXCL1 ELISA KIT|Human

EF003720 96 Tests
EUR 689.00

Rat CXCL1 shRNA Plasmid

20-abx986581
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human CXCL1 shRNA Plasmid

20-abx951972
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GRO-alpha/CXCL1, Human

HY-P7187 10ug
EUR 268.00

GRO-alpha/CXCL1, Rat

HY-P7189 50ug
EUR 533.00

Human CXCL1 ELISA Kit

LF-EK50891 1×96T
EUR 648.00

pEGFP- N1- CXCL1 Plasmid

PVT7155 2 ug
EUR 266.00

Rat keinocyte chemoattractant (KC) ELISA kit

E02K0088-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat keinocyte chemoattractant (KC) ELISA kit

E02K0088-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat keinocyte chemoattractant (KC) ELISA kit

E02K0088-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Leave a Reply

Your email address will not be published. Required fields are marked *